Phenylalanine-ammonialyase, PAL is transiently induced upon irradiation of UVB 310‚nm (Takeda and Abe, 1992). In biosynthesis of anthocyanin from phenylpropanod metabolism, a fower pigment, charconsynthase (CHS) is the key enzyme, while in initiation of the phenylpropanide metabolism upon the first signal transduction, the phenylalanine-ammonialyase (PAL) is the key enzyme (Takeda, Abe, Hirose, and Ozeki, 1993).

The following base-sequence is for cDNA of mRNA coded for PAL(Hirose 1992) from a cultured carrot cells in suspension.

 


 

>  ETKPAL  (Universal genetic code)
                                                          60
GAATTCCGGATCCAACTTCCCCATACACAAAACACATCAAAATTTTAAAATCATATCAAA
                                                           120
CACTTAGCTAAAAATGGATTGTGAGAACAAGAATGTTGTGCTAGGAAACGGGCTGTGCAT  
              M  D  C  E  N  K  N  V  V  L  G  N  G  L  C  M
                                                           180
GCAGAAAGATCCGTTGAACTGGGGAATGGCTGCGGAGGCCAAGACAGGAAGCCATTTGGA
  Q  K  D  P  L  N  W  G  M  A  A  E  A  K  T  G  S  H  L  D
                                                         240
TGAAGTCAAGAGGATGGTGGCTGAGTTTAGGAAGCCTATGGTGCAGCTTGGCGGGGAGAC
  E  V  K  R  M  V  A  E  F  R  K  P  M  V  Q  L  G  G  E  T
                                                         300
ACTCACCGTCTCTCAGGTGGCTGCTATTGCTGCAGGGAGTGTCAAGGTTGAGTTAGCCGA
  L  T  V  S  Q  V  A  A  I  A  A  G  S  V  K  V  E  L  A  E
                                                         360
GTCCGCGAGGGCTGGTGTCAAGGCTAGTAGTGATTGGGTGATGGAGAGCATGAACAAGGG
  S  A  R  A  G  V  K  A  S  S  D  W  V  M  E  S  M  N  K  G
                                                          420
AACTGATAGTTATGGTGTTACTACTGGTTTTGGTGCTACTTCTCATAGGAGGACAAAACA
  T  D  S  Y  G  V  T  T  G  F  G  A  T  S  H  R  R  T  K  Q
                                                         480
AGGTGGTGCTCTGCAGAAGGAACTTATTAGATTTTTGAACGCTGGAATCTTTGGAAGTGG
  G  G  A  L  Q  K  E  L  I  R  F  L  N  A  G  I  F  G  S  G
                                                         540
AAATGATTCTTCGAACATATTACCACATTCAGCAACAAGAGCAGCAATGCTAGTGAGGAT
  N  D  S  S  N  I  L  P  H  S  A  T  R  A  A  M  L  V  R  I
                                                         600
CAACACACTCCTCCAAGGTTACTCTGGCATTCGATTTGAAATTCTTGAGGCCATCACCAA
  N  T  L  L  Q  G  Y  S  G  I  R  F  E  I  L  E  A  I  T  K
                                                         660
GTTCCTCAACCAAAACATTACCCCTTGCTTGCCACTCCGTGGAACGATCACTGCTTCTGG
  F  L  N  Q  N  I  T  P  C  L  P  L  R  G  T  I  T  A  S  G
                                                         720
TGATCTTGTCCCTTTATCCTACATTGCTGGACTTCTAACTGGCCGTCCTAATTCCAAGGC
  D  L  V  P  L  S  Y  I  A  G  L  L  T  G  R  P  N  S  K  A
                                                         780
GGTTGGACCCACTGGAGAGAATCTGACTGCTGCAGAAGCATTTAAACTTGCTGGAGTTGA
  V  G  P  T  G  E  N  L  T  A  A  E  A  F  K  L  A  G  V  D
                                                         840
TGGTGGATTCTTTGAGCTGCAGCCAAAAGAAGGCCTTGCACTAGTCAATGGCACAGCTGT
  G  G  F  F  E  L  Q  P  K  E  G  L  A  L  V  N  G  T  A  V
                                                         900
CGGTTCTGGAATGGCTTCAATGGTACTGTTTGAGACCAATATACTTGCTGTGTTGGCTGA
  G  S  G  M  A  S  M  V  L  F  E  T  N  I  L  A  V  L  A  E
                                                         960
AGTTATGTCAGCTATCTTTGCTGAAGTGATGCAGGGCAAACCCGAATTTACTGACCATTT 
  V  M  S  A  I  F  A  E  V  M  Q  G  K  P  E  F  T  D  H  L 
                                                        1020
GACACACAAGTTGAAGCATCATCCTGGACAAATTGAAGCTGCAGCTATAATGGAACACAT 
  T  H  K  L  K  H  H  P  G  Q  I  E  A  A  A  I  M  E  H  I 
                                                        1080
CTTGGATGGAAGCTCTTATGTCAAGGCTGCTGAGAAGCAACACGAAATGGATCCATTGCA 
  L  D  G  S  S  Y  V  K  A  A  E  K  Q  H  E  M  D  P  L  Q 
                                                        1140
AAAACCAAAGCAAGATAGATATGCTCTTAGGACATCTCCACAATGGCTTGGACCACAGAT 
  K  P  K  Q  D  R  Y  A  L  R  T  S  P  Q  W  L  G  P  Q  I 
                                                        1200
TGAAGTGATTCGATCATCAACAAAAATGATAGAAAGGGAGATCAATTCTGTCAATGATAA 
  E  V  I  R  S  S  T  K  M  I  E  R  E  I  N  S  V  N  D  N 
                                                        1260
CCCTTTGATTGATGTGTCAAGGAACAAGGCCATCCATGGTGGTAACTTCCAGGGTACGCC 
  P  L  I  D  V  S  R  N  K  A  I  H  G  G  N  F  Q  G  T  P 
                                                        1320
TATTGGAGTTTCTATGGACAATACAAGGTTGGCTATTGCAGCAATTGGAAAGCTCATGTT 
  I  G  V  S  M  D  N  T  R  L  A  I  A  A  I  G  K  L  M  F 
                                                        1380
TGCCCAATTTTCGGAGCTTGTGAATGACTTTTATAACAATGGGCTGCCATCTAATCTCTC 
  A  Q  F  S  E  L  V  N  D  F  Y  N  N  G  L  P  S  N  L  S 
                                                        1440
TGGAGGGCGTAATCCAAGTTTGGATTATGGTTTCAAGGGTGCTGAAATTGCTATGGCTTC 
  G  G  R  N  P  S  L  D  Y  G  F  K  G  A  E  I  A  M  A  S  
                                                        1500
TTACTGCTCTGAGCAACAATTTTTGGGCAATCCAGTTACCAACCATGTTCAAAGCGCTGA 
  Y  C  S  E  Q  Q  F  L  G  N  P  V  T  N  H  V  Q  S  A  E 
                                                        1560
GCAACACAATCAAGATGTGAACTCACTAGGTTTGATCTCCTCAAGGAAAACAGCAGAAGC 
  Q  H  N  Q  D  V  N  S  L  G  L  I  S  S  R  K  T  A  E  A 
                                                        1620
TGTTGAAATCTTGAAGCTCATGTCTACCACATTTTTGGTAGGCCTCTGCCAAGCTGTAGA 
  V  E  I  L  K  L  M  S  T  T  F  L  V  G  L  C  Q  A  V  D 
                                                        1680
CCTGAGGCACTTGGAGGAGAACTTGAAGAGCACTGTCAAGAACACTGTAAGTCAAGTAGC 
  L  R  H  L  E  E  N  L  K  S  T  V  K  N  T  V  S  Q  V  A 
                                                        1740
CAAGAAAGTTCTAACTATGGGTGTCAATGGTGAGCTTCATCCTTCAAGATTCTGTGAGTT 
  K  K  V  L  T  M  G  V  N  G  E  L  H  P  S  R  F  C  E  L 
                                                        1800
GGATTTGCTTAGAGTTGTTGACAGGGAGTACATTTTCGCATACATTGACGACCCCTGCAG 
  D  L  L  R  V  V  D  R  E  Y  I  F  A  Y  I  D  D  P  C  S 
                                                        1860
TGCAACCTACCCACTGATGCAAAAGCTAAGACAGGTACTAGTTGAACATGCATTGAAAAA 
  A  T  Y  P  L  M  Q  K  L  R  Q  V  L  V  E  H  A  L  K  N 
                                                        1920
TGGCGAAACTGAGAAGAACTTGAGCACCTCAATCTTCCAAAAGATTGCAGCTTTTGAAGA 
  G  E  T  E  K  N  L  S  T  S  I  F  Q  K  I  A  A  F  E  D 
                                                        1980
TGAATTGAAGGCCCTTTTACCCAAGGAGGTTGAAAGTGCAAGGGCTGTGGTAGAGAGTGG 
  E  L  K  A  L  L  P  K  E  V  E  S  A  R  A  V  V  E  S  G 
                                                        2040
AAATCCTGCTATTCCAAACAGGATCAAAGAATGCAGGTCTTATCCACTGTACAAGTTTAT 
  N  P  A  I  P  N  R  I  K  E  C  R  S  Y  P  L  Y  K  F  I  
                                                        2100
CAGGGAAGAGCTGGGAACAGTTTATTTAACTGGCGAGAAAGTGACATCGCCTGGAGAAGA 
  R  E  E  L  G  T  V  Y  L  T  G  E  K  V  T  S  P  G  E  E 
                                                        2160
GTTTGACAAGGTGTTCACCGCAATGTCCAAAGGAGAGATCATTGATCCATTGTTGGCGTG 
  F  D  K  V  F  T  A  M  S  K  G  E  I  I  D  P  L  L  A  C 
                                                        2220
TCTTGAGAGCTGGAATGGTGCTCCTCTTCCAATTGCTTAGTTAAGATATGATGTGATTCT 
  L  E  S  W  N  G  A  P  L  P  I  A  .   
                                                        2280
AACTTATGTTATTTCAAGTATTGGTGTTTTTTAGTTGTTTAAAAATTGTGAATGCTGCCT 
                                                        2340
GTAAGAATCAATGCAATGAAGTGTTGCTTTTGTGAAATGGAAATATATCATAGTTTTGTT 
     2349
TGCATPLYAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA----polyA
//

Gene Library Home

Molecular Biology Home